EnhancerDB
  1. Home
  2. TFBS
  3. YY1[chr12:125255735-125255739]
Chromosome characteristics of YY1[chr12:125255735-125255739]
Back to top
Enhancers possibly regulated by YY1[chr12:125255735-125255739]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 125176905 125261395 enh2676
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Spleen Muscle (Myotube) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on YY1[chr12:125255735-125255739]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 125255737 rs150059868 ATTTCTTTTCTTTTCTTTTCT A 2973555
chr12 125255737 rs375343344 ATTTCTTTTCTTTTCTTTTCT A 2973556
chr12 125255737 rs79437716 A T 2973557
Genes possibly regulated by YY1[chr12:125255735-125255739]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by YY1[chr12:125255735-125255739]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results