Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 125255737 rs150059868 ATTTCTTTTCTTTTCTTTTCT A 2973555
chr12 125255737 rs375343344 ATTTCTTTTCTTTTCTTTTCT A 2973556
chr12 125255737 rs79437716 A T 2973557
chr12 125255740 rs571615661 T C 2973558
chr12 125255745 rs538786427 T C 2973559
chr12 125255749 rs551078945 T C 2973560

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results