Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 95198927 rs369304997 TGGTATCACTGTTACCTTTGCA T 1586527
chr10 95198927 rs572689525 TGGTATCACTGTTACCTTTGCA T 1586528
chr10 95198932 rs568592847 T A 1586529

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results