Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 79766585 79804035 enh24284

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 79789217 rs11271516 AGATATATGTTAAGTGTATTGG A 9913350
chr7 79789217 rs60325124 AGATATATGTTAAGTGTATTGG A 9913351

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results