EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:110328003-110328831]
Chromosome characteristics of ZNF274[chr1:110328003-110328831]
Back to top
Enhancers possibly regulated by ZNF274[chr1:110328003-110328831]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110323180 110341767 enh12126
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr1:110328003-110328831]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110328100 rs113283675 C T 548021
chr1 110328103 rs372232203 C T 548022
chr1 110328116 rs141257627 GC G 548023
chr1 110328187 rs72705269 G A 548024
chr1 110328206 rs6673747 G A 548025
chr1 110328232 rs115725113 G A 548026
chr1 110328265 rs112637349 TG T 548027
chr1 110328409 rs7544537 T C 548028
chr1 110328490 rs188123233 C A 548029
chr1 110328576 rs7528499 G A 548030
chr1 110328654 rs6674178 G A 548031
chr1 110328685 rs28523786 C A 548032
chr1 110328701 rs139271940 A G,T 548033
chr1 110328746 rs74430961 C T 548034
chr1 110328748 rs79975112 G A,C 548035
chr1 110328820 rs542239808 C A 548036
chr1 110328827 rs376653973 G GGAAAGGTCTGGGTTCCTGATTTGGCGCCCAGGCCCCTGTGTGT,GGCCCCTGTGTGT 548037
Genes possibly regulated by ZNF274[chr1:110328003-110328831]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:110328003-110328831]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results