EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:110434595-110435981]
Chromosome characteristics of ZNF274[chr1:110434595-110435981]
Back to top
Enhancers possibly regulated by ZNF274[chr1:110434595-110435981]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110412890 110446635 enh12129
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Adrenal Pancreas Uterus Blood (T-cell) Stomach Ovary Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
chr1 110435112 110435421 vista2881
VISTA
SNP sites on ZNF274[chr1:110434595-110435981]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110434791 rs333957 C A,G,T 549384
chr1 110434815 rs17025154 C T 549385
chr1 110434892 rs147253545 C T 549386
chr1 110434907 rs12091821 A G 549387
chr1 110434915 rs559380202 G A 549388
chr1 110435039 rs79460648 C T 549389
chr1 110435071 rs569599587 A G 549390
chr1 110435155 rs58409290 AG A 549391
chr1 110435155 rs879679432 AG A 549392
chr1 110435211 rs531563832 TGGGGAG T 549393
chr1 110435283 rs144560563 G A 549394
chr1 110435328 rs17608459 G A 549395
chr1 110435369 rs545080535 G A 549396
chr1 110435371 rs564151258 G A,C 549397
chr1 110435400 rs533149466 T C 549398
chr1 110435422 rs148469718 A T 549399
chr1 110435513 rs78104417 T C 549400
chr1 110435542 rs548972221 G A,T 549401
chr1 110435560 rs140752508 A ACGCCCTCTCCTCCAGCAGC 549402
chr1 110435598 rs551435851 C G 549403
chr1 110435616 rs142358989 G GCGCTC 549404
chr1 110435616 rs58004595 G GCGCTC 549405
chr1 110435665 rs112338482 T C 549406
chr1 110435735 rs142622571 A C 549407
chr1 110435779 rs150974923 G A 549408
chr1 110435821 rs563458053 G T 549409
chr1 110435877 rs140927928 T C 549410
chr1 110435880 rs55785346 A G 549411
chr1 110435901 rs144657626 C T 549412
chr1 110435973 rs201610201 TGCTGTTCTGTGG T 549413
Genes possibly regulated by ZNF274[chr1:110434595-110435981]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:110434595-110435981]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results