Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110435155 rs58409290 AG A 549391
chr1 110435155 rs879679432 AG A 549392
chr1 110435211 rs531563832 TGGGGAG T 549393
chr1 110435283 rs144560563 G A 549394
chr1 110435328 rs17608459 G A 549395
chr1 110435369 rs545080535 G A 549396
chr1 110435371 rs564151258 G A,C 549397
chr1 110435400 rs533149466 T C 549398
chr1 110435422 rs148469718 A T 549399
chr1 110435513 rs78104417 T C 549400
chr1 110435542 rs548972221 G A,T 549401
chr1 110435560 rs140752508 A ACGCCCTCTCCTCCAGCAGC 549402

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results