EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:110435458-110435828]
Chromosome characteristics of ZNF274[chr1:110435458-110435828]
Back to top
Enhancers possibly regulated by ZNF274[chr1:110435458-110435828]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110412890 110446635 enh12129
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Adrenal Pancreas Uterus Blood (T-cell) Stomach Ovary Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr1:110435458-110435828]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110435513 rs78104417 T C 549400
chr1 110435542 rs548972221 G A,T 549401
chr1 110435560 rs140752508 A ACGCCCTCTCCTCCAGCAGC 549402
chr1 110435598 rs551435851 C G 549403
chr1 110435616 rs142358989 G GCGCTC 549404
chr1 110435616 rs58004595 G GCGCTC 549405
chr1 110435665 rs112338482 T C 549406
chr1 110435735 rs142622571 A C 549407
chr1 110435779 rs150974923 G A 549408
chr1 110435821 rs563458053 G T 549409
Genes possibly regulated by ZNF274[chr1:110435458-110435828]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:110435458-110435828]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results