EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:151898550-151899167]
Chromosome characteristics of ZNF274[chr1:151898550-151899167]
Back to top
Enhancers possibly regulated by ZNF274[chr1:151898550-151899167]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 151885865 151921875 enh624
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ZNF274[chr1:151898550-151899167]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 151898599 rs113001874 G A 627882
chr1 151898659 rs111922151 T G 627883
chr1 151898749 rs2999541 G C 627884
chr1 151898829 rs142150117 C T 627885
chr1 151898843 rs56078223 T G 627886
chr1 151898876 rs182477998 C G 627887
chr1 151898884 rs142924977 C CCCAAGGGGGTTTTATTGGCT 627888
chr1 151898947 rs12562586 C G 627889
chr1 151898951 rs117293123 G A 627890
chr1 151899068 rs185736246 C T 627891
chr1 151899104 rs56000812 A G 627892
Genes possibly regulated by ZNF274[chr1:151898550-151899167]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:151898550-151899167]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results