EnhancerDB
  1. Home
  2. TFBS
  3. SOX2[chr1:151936585-151937202]
Chromosome characteristics of SOX2[chr1:151936585-151937202]
Back to top
Enhancers possibly regulated by SOX2[chr1:151936585-151937202]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 151932405 151955339 enh12260
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Stomach Placenta Colon (HCT116) Thyroid Lung (PC-9) Kidney Muscle (Myotube) Neural Stem Cells (H9) Heart
SNP sites on SOX2[chr1:151936585-151937202]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 151936606 rs61079201 TTATA T 628225
chr1 151936606 rs71710896 TTATA T 628226
chr1 151936606 rs763878119 TTATA T 628227
chr1 151936606 rs796770417 TTATA T 628228
chr1 151936627 rs2337688 T C 628229
chr1 151936629 rs2337689 T C 628230
chr1 151936639 rs556242700 T C 628231
chr1 151936690 rs574919577 TGTGTACCCCCATGGGTACTACAGGC T 628232
chr1 151936731 rs180706148 C T 628233
chr1 151937163 rs542588272 T G 628234
chr1 151937173 rs562574670 C T 628235
chr1 151937179 rs145539903 GT G 628236
Genes possibly regulated by SOX2[chr1:151936585-151937202]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SOX2[chr1:151936585-151937202]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results