EnhancerDB
  1. Home
  2. TFBS
  3. P63[chr1:203251145-203252155]
Chromosome characteristics of P63[chr1:203251145-203252155]
Back to top
Enhancers possibly regulated by P63[chr1:203251145-203252155]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 203242209 203262675 enh881
Bone Marrow (K562) Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on P63[chr1:203251145-203252155]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 203251237 rs187467643 T A 866330
chr1 203251237 rs573770294 TCCTCTGTCCTGCTCCCAATCCCCTC T 866331
chr1 203251253 rs201438893 C T 866332
chr1 203251306 rs140993309 G T 866333
chr1 203251468 rs115996466 G C,T 866334
chr1 203251481 rs545448969 A G 866335
chr1 203251559 rs533128537 T C 866336
chr1 203251563 rs546626142 C T 866337
chr1 203251567 rs144935213 G A 866338
chr1 203251661 rs568487770 C T 866339
chr1 203251938 rs2494276 T A 866340
Genes possibly regulated by P63[chr1:203251145-203252155]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by P63[chr1:203251145-203252155]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results