EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:207468187-207469397]
Chromosome characteristics of ZNF274[chr1:207468187-207469397]
Back to top
Enhancers possibly regulated by ZNF274[chr1:207468187-207469397]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 207468191 207488755 enh12602
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Cervix (HeLa-S3) Prostate (RWPE1) Ovary Esophagus Astrocyte Blood (OCI-LY7) Stomach Placenta Colon (HCT116) Lung (PC-9) Muscle (Myoblast) Pancreas (Panc1) Muscle (Myotube) Uterus Heart
SNP sites on ZNF274[chr1:207468187-207469397]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 207468238 rs186966720 G A,T 893898
chr1 207468339 rs73085203 T C 893899
chr1 207468410 rs139415373 G T 893900
chr1 207468423 rs6671998 G A 893901
chr1 207468615 rs557089111 T C 893902
chr1 207468790 rs559037758 GCTTTTTCCCCAATGTTTTCTTTTT G 893903
chr1 207469111 rs2782847 C T 893904
chr1 207469179 rs533187832 T C 893905
chr1 207469204 rs149702759 T A 893906
Genes possibly regulated by ZNF274[chr1:207468187-207469397]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:207468187-207469397]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results