EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:211513300-211518875]
Chromosome characteristics of ZNF274[chr1:211513300-211518875]
Back to top
Enhancers possibly regulated by ZNF274[chr1:211513300-211518875]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 211498150 211519175 enh904
Cervix (HeLa-S3) Large Intestine Blood (T-cell) Esophagus Bone (Osteoblast) Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Blood (Karpas-422) Pancreas Muscle (Myotube) Thymus Epithelial (MCF-7)
chr1 211517513 211517976 vista4959
VISTA
SNP sites on ZNF274[chr1:211513300-211518875]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 211513442 rs145890973 CCTTT C 915451
chr1 211513442 rs371675227 CCTTT C 915452
chr1 211513552 rs73072803 G C 915453
chr1 211513725 rs550480183 CA C 915454
chr1 211513751 rs538523790 C G,T 915455
chr1 211513754 rs193145522 G A 915456
chr1 211513759 rs569906652 T C 915457
chr1 211513784 rs537465568 G A 915458
chr1 211514102 rs144494882 G A 915459
chr1 211514126 rs4951743 T C 915460
chr1 211514158 rs141195306 G A 915461
chr1 211514594 rs114726033 C T 915462
chr1 211514663 rs180779280 C G 915463
chr1 211514809 rs113870288 G A 915464
chr1 211514879 rs115193173 A G 915465
chr1 211515070 rs55654731 C T 915466
chr1 211515091 rs116403778 C T 915467
chr1 211515321 rs143773037 A C 915468
chr1 211515340 rs147215621 C G 915469
chr1 211515430 rs115841827 T C 915470
chr1 211515588 rs138685241 C T 915471
chr1 211515780 rs551188578 G A 915472
chr1 211515874 rs61848977 T G 915473
chr1 211516262 rs6540683 G A 915474
chr1 211516457 rs555630258 G A,C 915475
chr1 211516521 rs79920051 C T 915476
chr1 211516754 rs186968421 A G 915477
chr1 211516777 rs558278249 TATATC T 915478
chr1 211516888 rs191804280 G A 915479
chr1 211516933 rs558559438 G C 915480
chr1 211516976 rs11582143 G C,T 915481
chr1 211517018 rs142560341 C G 915482
chr1 211517038 rs74341547 C A,T 915483
chr1 211517202 rs2280079 G A 915484
chr1 211517254 rs6672233 A G 915485
chr1 211517258 rs544039126 GGGCTTCCTAGTGGAGAACAA G 915486
chr1 211517330 rs114635538 T G 915487
chr1 211517542 rs556218240 A T 915488
chr1 211517765 rs6672742 A G 915489
chr1 211517815 rs59377914 G C 915490
chr1 211517827 rs182258078 T G 915491
chr1 211517889 rs186178185 G A 915492
chr1 211517928 rs6660490 C T 915493
chr1 211517980 rs111555578 G A,C,T 915494
chr1 211517984 rs541938715 C T 915495
chr1 211518089 rs141390461 G A 915496
chr1 211518113 rs7527620 A G 915497
chr1 211518123 rs78866185 C T 915498
chr1 211518222 rs79460064 A T 915499
chr1 211518323 rs60169087 A G 915500
chr1 211518410 rs145682451 G A 915501
chr1 211518486 rs182089843 C T 915502
chr1 211518496 rs187045442 T C 915503
chr1 211518516 rs143704705 C T 915504
chr1 211518642 rs142149847 C G 915505
chr1 211518702 rs117991054 C T 915506
chr1 211518708 rs115449674 C A,G 915507
chr1 211518710 rs113951708 C A,G,T 915508
chr1 211518711 rs145920479 C A,G,T 915509
chr1 211518715 rs530851470 C CT 915510
Genes possibly regulated by ZNF274[chr1:211513300-211518875]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:211513300-211518875]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results