EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:211910202-211913426]
Chromosome characteristics of ZNF274[chr1:211910202-211913426]
Back to top
Enhancers possibly regulated by ZNF274[chr1:211910202-211913426]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 211903585 211916175 enh908
Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Blood (T-cell) Esophagus Astrocyte Blood (OCI-LY7) Blood (GM12878) Stomach Muscle (A673) Thyroid Breast Blood (Karpas-422) Lung (PC-9) Pancreas Pancreas (Panc1) Thymus Epithelial (MCF-7)
chr1 211912030 211912428 vista4975
VISTA
SNP sites on ZNF274[chr1:211910202-211913426]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 211910227 rs188641750 G T 918693
chr1 211910241 rs146754752 G T 918694
chr1 211910252 rs697000 T C 918695
chr1 211910470 rs115307275 T C 918696
chr1 211910475 rs184357438 C T 918697
chr1 211910668 rs74745299 G A,T 918698
chr1 211910675 rs181706666 G A 918699
chr1 211910776 rs576343463 T C 918700
chr1 211910840 rs543728221 G C 918701
chr1 211910904 rs187580824 G A 918702
chr1 211910912 rs113788657 C T 918703
chr1 211911078 rs11119804 T C 918704
chr1 211911195 rs561517569 GGGGGGAGACAGGCCTTAGGGGCCA G 918705
chr1 211911200 rs58845507 G A,T 918706
chr1 211911212 rs535471464 A G 918707
chr1 211911218 rs553895962 C T 918708
chr1 211911219 rs72747036 A G 918709
chr1 211911264 rs150110636 G A 918710
chr1 211911345 rs368433023 TTTTTA T 918711
chr1 211911360 rs372979398 A AT 918712
chr1 211911360 rs538522527 A AT 918713
chr1 211911414 rs701910 C T 918714
chr1 211911424 rs72747038 C T 918715
chr1 211911465 rs537950255 C CCT 918716
chr1 211911516 rs143990191 C T 918717
chr1 211911602 rs117216789 C T 918718
chr1 211911791 rs551420212 T G 918719
chr1 211911830 rs139359159 C T 918720
chr1 211911846 rs73083389 G A 918721
chr1 211911918 rs149418260 G A 918722
chr1 211912422 rs548664442 C T 918723
chr1 211912494 rs72747039 C T 918724
chr1 211912809 rs34705738 CG C 918725
chr1 211912809 rs397800569 CG C 918726
chr1 211912833 rs150634936 C A 918727
chr1 211912952 rs372993105 G A 918728
chr1 211912955 rs115165723 C G 918729
chr1 211912990 rs139942992 C A,T 918730
chr1 211913160 rs116979531 C T 918731
chr1 211913192 rs73083391 G A 918732
Genes possibly regulated by ZNF274[chr1:211910202-211913426]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:211910202-211913426]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results