EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212109507-212110192]
Chromosome characteristics of ZNF274[chr1:212109507-212110192]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212109507-212110192]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212081505 212111174 enh12636
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Pancreas Stomach Epithelial (MCF-7) Skin (Keratinocyte) Bone (Osteoblast) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1)
SNP sites on ZNF274[chr1:212109507-212110192]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212109551 rs116507646 C G 919880
chr1 212109560 rs2993542 A C 919881
chr1 212109603 rs79708119 A C 919882
chr1 212109621 rs2970575 G A 919883
chr1 212109716 rs117951838 C T 919884
chr1 212109735 rs112793680 C A,T 919885
chr1 212109825 rs2993541 A G 919886
chr1 212109849 rs149613430 C CCACCA 919887
chr1 212109849 rs372019048 C CCACCA 919888
chr1 212109858 rs187355765 C T 919889
chr1 212109874 rs73091045 G C 919890
chr1 212110005 rs541202973 TTTAGACTTCTCACTACATCTCA T 919891
chr1 212110011 rs17018234 C G 919892
chr1 212110039 rs192619574 T C 919893
chr1 212110126 rs575072621 G A 919894
chr1 212110175 rs146460502 G A 919895
chr1 212110189 rs140760003 T A 919896
Genes possibly regulated by ZNF274[chr1:212109507-212110192]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:212109507-212110192]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results