EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212288148-212292321]
Chromosome characteristics of ZNF274[chr1:212288148-212292321]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212288148-212292321]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212276365 212288295 enh67261
Bone Marrow (K562) Brain (SK-N-MC) Muscle (A673) Neural Stem Cells (H9) Stomach
chr1 212289525 212302849 enh58214
Bone Marrow (K562) Skin (Keratinocyte) Esophagus Blood (OCI-LY7) Stomach Neural Stem Cells (H9) Heart
chr1 212291571 212291809 vista4988
VISTA
SNP sites on ZNF274[chr1:212288148-212292321]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212288175 rs1965955 G C 920452
chr1 212288188 rs181114093 G A 920453
chr1 212288221 rs112857151 GTT G 920454
chr1 212288339 rs145333368 T TTGTCATGGTGATTGTCAAC 920455
chr1 212288339 rs71137720 T TTGTCATGGTGATTGTCAAC 920456
chr1 212288480 rs114782331 A T 920457
chr1 212288560 rs185870943 T C 920458
chr1 212288631 rs114864218 A G 920459
chr1 212288658 rs190382464 A T 920460
chr1 212288714 rs374154080 C G,T 920461
chr1 212288715 rs368415337 G A 920462
chr1 212288767 rs146182324 C T 920463
chr1 212288790 rs552645637 C T 920464
chr1 212288816 rs187888890 G A 920465
chr1 212288924 rs568070639 C T 920466
chr1 212289037 rs182728378 A C 920467
chr1 212289076 rs560041811 G A 920468
chr1 212289218 rs139048174 T C 920469
chr1 212289306 rs149486511 T G 920470
chr1 212289454 rs562041663 G C 920471
chr1 212289616 rs532174880 C T 920472
chr1 212289625 rs13328711 G A 920473
chr1 212289677 rs371358734 CA C 920474
chr1 212289677 rs59349519 CA C 920475
chr1 212289731 rs531060416 C T 920476
chr1 212289779 rs549229140 C T 920477
chr1 212289806 rs532381969 A AC 920478
chr1 212289809 rs557338999 C T 920479
chr1 212289810 rs12086580 G A 920480
chr1 212289829 rs577428420 AAAAATATATATATATATATATATAT A 920481
chr1 212289976 rs61830764 G A 920482
chr1 212289988 rs141010161 G T 920483
chr1 212290050 rs540885981 A C,G 920484
chr1 212290122 rs144666554 A G 920485
chr1 212290139 rs57157835 A G 920486
chr1 212290348 rs189263032 G A 920487
chr1 212290464 rs147877379 T C 920488
chr1 212290542 rs12408673 G A 920489
chr1 212290605 rs571948949 C A 920490
chr1 212290637 rs150432570 G A 920491
chr1 212290684 rs554243161 G A 920492
chr1 212290725 rs12401317 C T 920493
chr1 212290934 rs149092523 C G,T 920494
chr1 212290937 rs545645317 C G 920495
chr1 212290998 rs565246360 G A 920496
chr1 212291089 rs116378479 G C 920497
chr1 212291108 rs115590741 G A 920498
chr1 212291218 rs143127396 C T 920499
chr1 212291227 rs138785962 A G 920500
chr1 212291275 rs575663285 G A 920501
chr1 212291291 rs556419049 G A 920502
chr1 212291339 rs183869771 G A 920503
chr1 212291346 rs140411096 G A 920504
chr1 212291602 rs150439972 TAAG T 920505
chr1 212291602 rs35559953 TAAG T 920506
chr1 212291681 rs79924620 A T 920507
chr1 212291742 rs74140405 T C 920508
chr1 212291812 rs111637578 C A,T 920509
chr1 212291813 rs557954699 G A 920510
chr1 212291821 rs190905113 C T 920511
chr1 212291936 rs187287143 C T 920512
chr1 212291987 rs554119571 C T 920513
chr1 212292090 rs4951568 C T 920514
chr1 212292201 rs2358438 T C 920515
Genes possibly regulated by ZNF274[chr1:212288148-212292321]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr1:212288148-212292321]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results