Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212457974 rs542933487 AGTAGCTCTCTGGAGTTGCG A 922212
chr1 212457987 rs72752376 A G 922213
chr1 212458011 rs568326352 G C 922214
chr1 212458049 rs72752377 T C,G 922215
chr1 212458123 rs351412 C T 922216
chr1 212458127 rs76606646 C T 922217
chr1 212458242 rs114170887 C A 922218
chr1 212458285 rs530566198 A G 922219
chr1 212458317 rs968532 G T 922220
chr1 212458327 rs567219084 A G 922221
chr1 212458357 rs546850527 G A 922222

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 212458879 212535200 + PPP2R5A ENSG00000066027.7 212458879 0.76 0.99 503 1825


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results