EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr1:212457969-212458359]
Chromosome characteristics of ZNF274[chr1:212457969-212458359]
Back to top
Enhancers possibly regulated by ZNF274[chr1:212457969-212458359]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 212456045 212470579 enh910
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Lung (PC-9) Esophagus Bone (Osteoblast) Lung Blood (OCI-LY7) Blood (GM12878) Colon (HCT116) Uterus Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Neural Stem Cells (H9) Stomach
chr1 212458080 212458253 vista4993
VISTA
SNP sites on ZNF274[chr1:212457969-212458359]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 212457974 rs542933487 AGTAGCTCTCTGGAGTTGCG A 922212
chr1 212457987 rs72752376 A G 922213
chr1 212458011 rs568326352 G C 922214
chr1 212458049 rs72752377 T C,G 922215
chr1 212458123 rs351412 C T 922216
chr1 212458127 rs76606646 C T 922217
chr1 212458242 rs114170887 C A 922218
chr1 212458285 rs530566198 A G 922219
chr1 212458317 rs968532 G T 922220
chr1 212458327 rs567219084 A G 922221
chr1 212458357 rs546850527 G A 922222
Genes possibly regulated by ZNF274[chr1:212457969-212458359]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 212458879 212535200 + PPP2R5A ENSG00000066027.7 212458879 0.76 0.99 520 1825
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr1:212457969-212458359]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results