EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr11:65236161-65237095]
Chromosome characteristics of ZNF143[chr11:65236161-65237095]
Back to top
Enhancers possibly regulated by ZNF143[chr11:65236161-65237095]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 65232865 65270235 enh1826
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF143[chr11:65236161-65237095]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 65236193 rs191690633 C A 2046188
chr11 65236206 rs577131000 C G,T 2046189
chr11 65236643 rs138182218 GTTTT G 2046190
chr11 65236643 rs930832232 GTTTT G 2046191
chr11 65236858 rs564426286 A G 2046192
chr11 65236925 rs535391219 TGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCA T 2046193
chr11 65236957 rs533100847 A T 2046194
chr11 65236959 rs546601178 C G 2046195
chr11 65237033 rs140739168 G A 2046196
chr11 65237047 rs112454205 G A,T 2046197
Genes possibly regulated by ZNF143[chr11:65236161-65237095]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr11:65236161-65237095]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results