Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 65236643 rs138182218 GTTTT G 2046190
chr11 65236643 rs930832232 GTTTT G 2046191
chr11 65236858 rs564426286 A G 2046192
chr11 65236925 rs535391219 TGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCA T 2046193
chr11 65236957 rs533100847 A T 2046194
chr11 65236959 rs546601178 C G 2046195

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results