EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr12:46777293-46777609]
Chromosome characteristics of ZNF274[chr12:46777293-46777609]
Back to top
Enhancers possibly regulated by ZNF274[chr12:46777293-46777609]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 46774225 46791355 enh14675
Brain (SK-N-MC) Astrocyte Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Esophagus Placenta Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr12:46777293-46777609]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 46777388 rs543467241 AGGAGGAGGCGAAGAGGAGGCGG A 2603464
chr12 46777400 rs567378833 A AGAGGAGGCGGG 2603465
chr12 46777419 rs544475108 CGGGGAGGAGGG C 2603466
chr12 46777430 rs575084262 G C 2603467
chr12 46777432 rs540618589 G T 2603468
Genes possibly regulated by ZNF274[chr12:46777293-46777609]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr12:46777293-46777609]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results