EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr12:52611039-52611609]
Chromosome characteristics of ZNF217[chr12:52611039-52611609]
Back to top
Enhancers possibly regulated by ZNF217[chr12:52611039-52611609]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 52591245 52620175 enh14727
Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZNF217[chr12:52611039-52611609]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 52611050 rs10783499 A G 2636972
chr12 52611052 rs7316130 G A 2636973
chr12 52611070 rs548000982 G A 2636974
chr12 52611098 rs117192181 G C 2636975
chr12 52611229 rs183102524 G C 2636976
chr12 52611248 rs10876245 T G 2636977
chr12 52611451 rs10876246 G C 2636978
chr12 52611457 rs573329998 AGGACTTTTTTTTTTCTGTAT A 2636979
chr12 52611461 rs66621436 CT C 2636980
chr12 52611507 rs10876247 C A 2636981
chr12 52611521 rs112638892 A G 2636982
chr12 52611553 rs114655175 A T 2636983
Genes possibly regulated by ZNF217[chr12:52611039-52611609]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr12:52611039-52611609]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results