Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 58238402 rs11832073 G A 2664456
chr12 58238408 rs77400978 G C 2664457
chr12 58238416 rs547952162 T A 2664458
chr12 58238461 rs370526118 C T 2664459
chr12 58238467 rs201492405 GCA G 2664460
chr12 58238467 rs867886662 GCA G 2664461
chr12 58238472 rs184947448 G A 2664462
chr12 58238847 rs576061058 G A 2664463
chr12 58238985 rs149286879 CGCCCCAGCCTCCGGGGCCAGGTG C 2664464

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 58213710 58240522 - CTDSP2 ENSG00000175215.5 58240522 0.65 1.0 1445 12272


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 58218403 58218424 - hsa-miR-26a-2-3p MIMAT0004681 58240493 0.537666 0.501351 1416 306