EnhancerDB
  1. Home
  2. TFBS
  3. POL24H8[chr12:66001423-66001719]
Chromosome characteristics of POL24H8[chr12:66001423-66001719]
Back to top
Enhancers possibly regulated by POL24H8[chr12:66001423-66001719]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 65985125 66011195 enh47591
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Prostate (RWPE1) Esophagus Stomach Muscle (A673) Colon (HCT116) Uterus Lung (PC-9) Neural Stem Cells (H9) Thymus Epithelial (MCF-7)
SNP sites on POL24H8[chr12:66001423-66001719]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 66001593 rs139931902 G A,T 2694415
chr12 66001595 rs73329847 C T 2694416
chr12 66001611 rs73329849 G A 2694417
chr12 66001646 rs374341445 GCAGATGTGGTGTGCACCACTTC G 2694418
Genes possibly regulated by POL24H8[chr12:66001423-66001719]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POL24H8[chr12:66001423-66001719]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results