EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:55553744-55553928]
Chromosome characteristics of ZNF274[chr14:55553744-55553928]
Back to top
Enhancers possibly regulated by ZNF274[chr14:55553744-55553928]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 55550545 55578795 enh15631
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZNF274[chr14:55553744-55553928]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 55553753 rs72716648 T C 3559374
chr14 55553786 rs2879885 C T 3559375
chr14 55553818 rs114825662 C T 3559376
chr14 55553855 rs186324179 A G,T 3559377
chr14 55553866 rs570352432 CTGCTGATTGGTCCATTTTACAGAG C 3559378
chr14 55553910 rs574092067 GA G 3559379
Genes possibly regulated by ZNF274[chr14:55553744-55553928]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:55553744-55553928]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results