EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:61564200-61565517]
Chromosome characteristics of ZNF274[chr14:61564200-61565517]
Back to top
Enhancers possibly regulated by ZNF274[chr14:61564200-61565517]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 61563565 61582555 enh3250
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Uterus Stomach Skin (Keratinocyte) Bone (Osteoblast) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on ZNF274[chr14:61564200-61565517]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 61564206 rs140847951 C G,T 3586705
chr14 61564248 rs190826101 C T 3586706
chr14 61564278 rs144599743 C T 3586707
chr14 61564351 rs193085949 G A 3586708
chr14 61564363 rs138466685 C A 3586709
chr14 61564380 rs184618213 T G 3586710
chr14 61564549 rs189096512 C T 3586711
chr14 61564624 rs111330155 G A 3586712
chr14 61564674 rs577641149 CTCAGCAATGGTGGACGCCCCTCCCCCAGCCTCACTGTCACCTTGCAGT C 3586713
chr14 61564714 rs575501540 C A,T 3586714
chr14 61564768 rs8006576 A C,G 3586715
chr14 61564779 rs188395655 C T 3586716
chr14 61564790 rs111262224 C G 3586717
chr14 61564801 rs550890864 C T 3586718
chr14 61564826 rs12881469 A C 3586719
chr14 61564837 rs12881623 C T 3586720
chr14 61564853 rs113489384 G A 3586721
chr14 61564908 rs186736610 G T 3586722
chr14 61564975 rs145358126 G A 3586723
chr14 61565006 rs541923800 G A 3586724
chr14 61565021 rs192457363 C A,T 3586725
chr14 61565057 rs4031822 G A 3586726
chr14 61565191 rs551083218 GTCGGT G 3586727
chr14 61565234 rs139798742 C T 3586728
chr14 61565308 rs56095027 G A 3586729
chr14 61565327 rs149789390 T C 3586730
chr14 61565421 rs567857727 T C 3586731
Genes possibly regulated by ZNF274[chr14:61564200-61565517]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:61564200-61565517]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results