EnhancerDB
  1. Home
  2. TFBS
  3. MYOD[chr14:61574035-61574732]
Chromosome characteristics of MYOD[chr14:61574035-61574732]
Back to top
Enhancers possibly regulated by MYOD[chr14:61574035-61574732]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 61563565 61582555 enh3250
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Uterus Stomach Skin (Keratinocyte) Bone (Osteoblast) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
SNP sites on MYOD[chr14:61574035-61574732]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 61574050 rs374067947 C T 3586834
chr14 61574055 rs1571382 A G 3586835
chr14 61574103 rs183636074 G A 3586836
chr14 61574312 rs542540707 G A 3586837
chr14 61574466 rs73313331 G A 3586838
chr14 61574685 rs553642308 A ACTGGCAGGTTCCTCCAGAGCTACAGCT 3586839
Genes possibly regulated by MYOD[chr14:61574035-61574732]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYOD[chr14:61574035-61574732]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results