EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:65116936-65117606]
Chromosome characteristics of ZNF143[chr14:65116936-65117606]
Back to top
Enhancers possibly regulated by ZNF143[chr14:65116936-65117606]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65075625 65118315 enh15680
Brain (SK-N-MC) Liver Astrocyte Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on ZNF143[chr14:65116936-65117606]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65117078 rs561777994 G A,T 3605847
chr14 65117113 rs192091614 C T 3605848
chr14 65117117 rs546096114 G A 3605849
chr14 65117177 rs4902303 T C 3605850
chr14 65117269 rs568911976 A C 3605851
chr14 65117395 rs184184996 G A,T 3605852
chr14 65117414 rs148115854 T C 3605853
chr14 65117425 rs140287379 GTCTGGTCTCCAACTCCTGGCC G 3605854
chr14 65117425 rs369071282 GTCTGGTCTCCAACTCCTGGCC G 3605855
chr14 65117450 rs71416333 G T 3605856
chr14 65117544 rs544287326 T C 3605857
Genes possibly regulated by ZNF143[chr14:65116936-65117606]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:65116936-65117606]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results