EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:70161333-70161923]
Chromosome characteristics of ZZZ3[chr14:70161333-70161923]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:70161333-70161923]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 70147385 70168895 enh3309
Bone Marrow (K562) Astrocyte Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr14 70161683 70161933 vista18331
VISTA
SNP sites on ZZZ3[chr14:70161333-70161923]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 70161422 rs148892524 A T 3635983
chr14 70161435 rs80270790 G C 3635984
chr14 70161445 rs530078176 G A 3635985
chr14 70161446 rs541866882 C A 3635986
chr14 70161543 rs561188732 T C 3635987
chr14 70161564 rs1889727 C A,G 3635988
chr14 70161587 rs67737953 C T 3635989
chr14 70161633 rs200538479 G GC 3635990
chr14 70161653 rs571497952 G C 3635991
chr14 70161830 rs544315862 GTCTCATAGGAGAGGAAGGTTGCAAATGGCATGAGAAACCA G 3635992
chr14 70161910 rs75892139 T G 3635993
Genes possibly regulated by ZZZ3[chr14:70161333-70161923]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:70161333-70161923]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results