EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr15:40353500-40354184]
Chromosome characteristics of ZZZ3[chr15:40353500-40354184]
Back to top
Enhancers possibly regulated by ZZZ3[chr15:40353500-40354184]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 40353665 40379655 enh16061
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZZZ3[chr15:40353500-40354184]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 40353504 rs200205757 CGTCT C 3910153
chr15 40353504 rs375410538 CGTCT C 3910154
chr15 40353521 rs577242916 G A 3910155
chr15 40353538 rs368494133 T C 3910156
chr15 40353569 rs562565576 A G 3910157
chr15 40353589 rs74009111 A G 3910158
chr15 40353604 rs148049217 CATGCATGCATCCATTGTGAGGAAGAAAGGTAGCAGCGGGCATAG C 3910159
chr15 40353610 rs562250789 T G 3910160
chr15 40353630 rs112850695 A G 3910161
chr15 40353776 rs536086790 G A 3910162
chr15 40353870 rs376520377 G GAA 3910163
chr15 40353870 rs532043813 G GAA 3910164
chr15 40353889 rs72731419 G A 3910165
chr15 40353922 rs539749623 T A,C 3910166
Genes possibly regulated by ZZZ3[chr15:40353500-40354184]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr15:40353500-40354184]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results