Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 40353504 rs200205757 CGTCT C 3910153
chr15 40353504 rs375410538 CGTCT C 3910154
chr15 40353521 rs577242916 G A 3910155
chr15 40353538 rs368494133 T C 3910156
chr15 40353569 rs562565576 A G 3910157
chr15 40353589 rs74009111 A G 3910158
chr15 40353604 rs148049217 CATGCATGCATCCATTGTGAGGAAGAAAGGTAGCAGCGGGCATAG C 3910159
chr15 40353610 rs562250789 T G 3910160
chr15 40353630 rs112850695 A G 3910161
chr15 40353776 rs536086790 G A 3910162
chr15 40353870 rs376520377 G GAA 3910163
chr15 40353870 rs532043813 G GAA 3910164
chr15 40353889 rs72731419 G A 3910165
chr15 40353922 rs539749623 T A,C 3910166

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results