EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr15:99980487-99982613]
Chromosome characteristics of ZNF143[chr15:99980487-99982613]
Back to top
Enhancers possibly regulated by ZNF143[chr15:99980487-99982613]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 99971645 99998102 enh16467
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Prostate (RWPE1) Lung Heart
SNP sites on ZNF143[chr15:99980487-99982613]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 99980508 rs76677884 C T 4225702
chr15 99980551 rs7162817 T C 4225703
chr15 99980622 rs143753249 T C 4225704
chr15 99980666 rs73474883 G A 4225705
chr15 99980822 rs78460974 G A 4225706
chr15 99980835 rs138606249 A G 4225707
chr15 99980864 rs35158282 A G 4225708
chr15 99981013 rs560225971 C T 4225709
chr15 99981069 rs540767472 A AGGGAGAATCTCATCTACCACCTACTGGGTGGATAACTAT 4225710
chr15 99981213 rs145253346 G A 4225711
chr15 99981269 rs4965490 T C,G 4225712
chr15 99981333 rs576440337 C T 4225713
chr15 99981385 rs137908011 T C 4225714
chr15 99981440 rs186237040 A G 4225715
chr15 99981485 rs188163142 A C 4225716
chr15 99981582 rs186447882 G A 4225717
chr15 99981588 rs548366871 C G 4225718
chr15 99981615 rs28528723 G A 4225719
chr15 99981754 rs566581333 G C 4225720
chr15 99981781 rs537587782 C A,T 4225721
chr15 99981807 rs529840873 AG A 4225722
chr15 99981907 rs190808948 G A 4225723
chr15 99981964 rs532157459 TA T 4225724
chr15 99982000 rs542669485 T C 4225725
chr15 99982030 rs560903301 A G 4225726
chr15 99982157 rs183577805 G A 4225727
chr15 99982182 rs7165066 C T 4225728
chr15 99982197 rs11636993 T C 4225729
chr15 99982447 rs7170529 A C 4225730
chr15 99982525 rs73474892 G A 4225731
Genes possibly regulated by ZNF143[chr15:99980487-99982613]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr15:99980487-99982613]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results