EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:369600-371462]
Chromosome characteristics of TCF7L2[chr16:369600-371462]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:369600-371462]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 364825 394775 enh16487
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Muscle (A673) Heart
chr16 369599 369830 vista21507
VISTA
SNP sites on TCF7L2[chr16:369600-371462]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 369675 rs568166382 C G,T 4245061
chr16 369678 rs114955704 G A 4245062
chr16 369704 rs184239346 C T 4245063
chr16 369705 rs141144815 G A 4245064
chr16 369743 rs540285906 C T 4245065
chr16 369953 rs551106080 T C 4245066
chr16 370066 rs17136110 C T 4245067
chr16 370067 rs78419541 C T 4245068
chr16 370074 rs183689839 G A 4245069
chr16 370178 rs117292704 G A 4245070
chr16 370336 rs3848362 A C,G 4245071
chr16 370443 rs117116749 G A 4245072
chr16 370484 rs3848363 T C 4245073
chr16 370662 rs150311779 T C 4245074
chr16 370689 rs59041497 A G 4245075
chr16 370723 rs1143874 G A 4245076
chr16 370725 rs185385934 A G 4245077
chr16 370795 rs531311871 A G 4245078
chr16 370796 rs369150744 G A 4245079
chr16 370815 rs138748070 C CTACAACCTCCGCCTCCTGGG,CTGGG 4245080
chr16 370815 rs58703541 C CTACAACCTCCGCCTCCTGGG 4245081
chr16 370825 rs562983189 C T 4245082
chr16 370826 rs533572190 G A 4245083
chr16 370888 rs527942800 C T 4245084
chr16 370936 rs564373006 C T 4245085
chr16 370937 rs183435767 G A 4245086
chr16 370945 rs187635057 G A 4245087
chr16 370947 rs452972 T A,C,G 4245088
chr16 370962 rs182148979 A T 4245089
chr16 370973 rs139322963 T C 4245090
chr16 370984 rs143285918 C G,T 4245091
chr16 370990 rs561165570 G A 4245092
chr16 370996 rs550042250 C T 4245093
chr16 371010 rs148496785 T C 4245094
chr16 371018 rs539109357 T A,C,G 4245095
chr16 371020 rs185037391 A G 4245096
chr16 371030 rs554848759 G A 4245097
chr16 371035 rs537033128 C G,T 4245098
chr16 371103 rs141841357 G A 4245099
chr16 371138 rs115971096 G A 4245100
chr16 371198 rs76181712 C T 4245101
chr16 371199 rs150640112 G A 4245102
chr16 371396 rs569946371 C T 4245103
chr16 371397 rs537009142 G A 4245104
chr16 371421 rs184626431 G C,T 4245105
Genes possibly regulated by TCF7L2[chr16:369600-371462]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:369600-371462]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results