EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:1238847-1239332]
Chromosome characteristics of TCF7L2[chr16:1238847-1239332]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:1238847-1239332]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1228905 1244901 enh31664
Liver (HepG2) Prostate (RWPE1) Ovary Astrocyte Bone (Osteoblast) Stomach Muscle (A673) Colon (HCT116) Thyroid Pancreas Uterus Epithelial (MCF-7)
chr16 1239202 1239436 vista21542
VISTA
SNP sites on TCF7L2[chr16:1238847-1239332]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1238875 rs117177120 T G 4254531
chr16 1238918 rs540739913 G A 4254532
chr16 1238926 rs184629894 C G 4254533
chr16 1238936 rs371534242 G A 4254534
chr16 1238939 rs12444811 A G 4254535
chr16 1239026 rs111616044 G C 4254536
chr16 1239065 rs527739620 A AGGGGAGCGCTTACTGCCGCAGAAAGGAGGCTGGG 4254537
chr16 1239082 rs184509945 C T 4254538
chr16 1239124 rs146929213 G A 4254539
chr16 1239144 rs79796885 A C,G 4254540
chr16 1239308 rs549772986 C T 4254541
Genes possibly regulated by TCF7L2[chr16:1238847-1239332]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:1238847-1239332]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results