EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:85231714-85232625]
Chromosome characteristics of ZNF274[chr16:85231714-85232625]
Back to top
Enhancers possibly regulated by ZNF274[chr16:85231714-85232625]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85219145 85290912 enh16864
Bone Marrow (K562) Astrocyte Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr16:85231714-85232625]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85231734 rs141742994 G T 4618307
chr16 85231858 rs190920098 C G,T 4618308
chr16 85231859 rs117843924 G A 4618309
chr16 85231922 rs144890035 CAG C 4618310
chr16 85231970 rs182808899 C T 4618311
chr16 85231977 rs10083744 T C 4618312
chr16 85232140 rs77447251 T A 4618313
chr16 85232154 rs542401499 C T 4618314
chr16 85232158 rs116112402 A G 4618315
chr16 85232237 rs368954860 CCCTGGATGCCACGGTTCTTT C 4618316
chr16 85232249 rs4494523 C T 4618317
chr16 85232306 rs557290626 AC A 4618318
chr16 85232530 rs539791918 A T 4618319
chr16 85232548 rs4782691 C A,G 4618320
Genes possibly regulated by ZNF274[chr16:85231714-85232625]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:85231714-85232625]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results