Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85240289 rs572074064 G A 4618468
chr16 85240370 rs569777105 GCCGCCAGGATGGAGGTGCTGGCCCC G 4618469

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results