EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:85274594-85274954]
Chromosome characteristics of ZNF274[chr16:85274594-85274954]
Back to top
Enhancers possibly regulated by ZNF274[chr16:85274594-85274954]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85219145 85290912 enh16864
Bone Marrow (K562) Astrocyte Colon (HCT116) Adrenal Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr16:85274594-85274954]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85274688 rs527941904 C T 4619141
chr16 85274689 rs28612891 G A 4619142
chr16 85274780 rs564979188 TGACCTTGGGCTCGGCTGCGA T 4619143
chr16 85274800 rs28467482 A T 4619144
chr16 85274867 rs117628616 G A 4619145
chr16 85274900 rs74031739 G A 4619146
Genes possibly regulated by ZNF274[chr16:85274594-85274954]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:85274594-85274954]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results