EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:85368887-85370644]
Chromosome characteristics of ZNF274[chr16:85368887-85370644]
Back to top
Enhancers possibly regulated by ZNF274[chr16:85368887-85370644]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85333005 85372015 enh16866
Bone Marrow (K562) Brain (SK-N-MC) Liver Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Pancreas (Panc1) Neural Stem Cells (H9) Thymus Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr16:85368887-85370644]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85368974 rs8061803 G A 4621014
chr16 85368984 rs4783167 A G 4621015
chr16 85369011 rs527345060 T C 4621016
chr16 85369023 rs142465712 A T 4621017
chr16 85369058 rs542531878 TGCAGGAGGCGGAGGCCGTGCTGTGCGGGCTG T 4621018
chr16 85369067 rs8061671 C T 4621019
chr16 85369074 rs114607597 C T 4621020
chr16 85369099 rs183306404 G A 4621021
chr16 85369155 rs376820734 G A 4621022
chr16 85369224 rs139058893 C T 4621023
chr16 85369268 rs112642237 C T 4621024
chr16 85369330 rs115057581 A C 4621025
chr16 85369372 rs60431659 C T 4621026
chr16 85369451 rs397766265 G GC 4621027
chr16 85369451 rs71151280 G GC 4621028
chr16 85369474 rs77734683 G A 4621029
chr16 85369534 rs74031792 A G 4621030
chr16 85369759 rs58266498 G T 4621031
chr16 85369884 rs113113760 C T 4621032
chr16 85369899 rs142069921 T G 4621033
chr16 85370006 rs113459180 G A 4621034
chr16 85370020 rs183454318 G A 4621035
chr16 85370068 rs545846104 G A 4621036
chr16 85370170 rs145574447 C A 4621037
chr16 85370186 rs148894925 C A 4621038
chr16 85370230 rs2326525 T C 4621039
chr16 85370247 rs143615928 G A 4621040
chr16 85370416 rs2326526 A G 4621041
chr16 85370472 rs543680091 G A 4621042
chr16 85370509 rs148294485 C T 4621043
chr16 85370510 rs75891708 G A 4621044
chr16 85370528 rs2326527 A G 4621045
chr16 85370585 rs4783168 T C 4621046
chr16 85370612 rs531861029 AC A 4621047
chr16 85370618 rs563775767 C A 4621048
chr16 85370624 rs373181140 G A 4621049
Genes possibly regulated by ZNF274[chr16:85368887-85370644]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:85368887-85370644]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results