Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85368974 rs8061803 G A 4621014
chr16 85368984 rs4783167 A G 4621015
chr16 85369011 rs527345060 T C 4621016
chr16 85369023 rs142465712 A T 4621017
chr16 85369058 rs542531878 TGCAGGAGGCGGAGGCCGTGCTGTGCGGGCTG T 4621018
chr16 85369067 rs8061671 C T 4621019
chr16 85369074 rs114607597 C T 4621020
chr16 85369099 rs183306404 G A 4621021

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results