EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:85424463-85425406]
Chromosome characteristics of TCF7L2[chr16:85424463-85425406]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:85424463-85425406]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85422125 85439595 enh4173
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Stomach Epithelial (MCF-7) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Placenta Breast Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673)
chr16 85424430 85424739 vista23302
VISTA
SNP sites on TCF7L2[chr16:85424463-85425406]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85424556 rs66907603 G A 4622115
chr16 85424564 rs550716167 G A,C 4622116
chr16 85424605 rs376688311 G A 4622117
chr16 85424634 rs551765883 C A,T 4622118
chr16 85424700 rs369022209 C A,G 4622119
chr16 85424704 rs191896320 G A 4622120
chr16 85424882 rs545372417 C T 4622121
chr16 85424896 rs139062384 A C 4622122
chr16 85424946 rs541694259 A G 4622123
chr16 85424961 rs530312983 C T 4622124
chr16 85425167 rs557476015 C T 4622125
chr16 85425182 rs149904569 C T 4622126
chr16 85425229 rs144924517 C T 4622127
chr16 85425237 rs900761 G A 4622128
chr16 85425361 rs193160681 G A 4622129
chr16 85425370 rs566373236 AGGTCACTGGAGTAGATGCTTGTGG A 4622130
chr16 85425400 rs560404777 C T 4622131
Genes possibly regulated by TCF7L2[chr16:85424463-85425406]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:85424463-85425406]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results