Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85640485 85664563 enh16874
chr16 85648720 85648939 vista23334

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85648870 rs137882357 C T 4626355
chr16 85648892 rs551989019 C T 4626356
chr16 85649008 rs577800717 TCTC T 4626357
chr16 85649086 rs573802476 GCTGGAGCCAACCACGGTTTTGACGCTTGGAGTTTTCTTTC G 4626358
chr16 85649256 rs534261071 C T 4626359
chr16 85649322 rs542636277 T C 4626360
chr16 85649390 rs150110233 C T 4626361
chr16 85649482 rs116187584 G A,C 4626362
chr16 85649505 rs529719021 G T 4626363

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results