EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:85648916-85649420]
Chromosome characteristics of ZNF274[chr16:85648916-85649420]
Back to top
Enhancers possibly regulated by ZNF274[chr16:85648916-85649420]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 85640485 85664563 enh16874
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Brain (SK-N-SH) Large Intestine Liver Stomach Muscle (A673) Placenta Embryonic Stem Cell Line (H1-hESC) Pancreas Muscle (Myotube) Uterus Blood (T-cell) Heart
chr16 85648720 85648939 vista23334
VISTA
SNP sites on ZNF274[chr16:85648916-85649420]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 85649008 rs577800717 TCTC T 4626357
chr16 85649086 rs573802476 GCTGGAGCCAACCACGGTTTTGACGCTTGGAGTTTTCTTTC G 4626358
chr16 85649256 rs534261071 C T 4626359
chr16 85649322 rs542636277 T C 4626360
chr16 85649390 rs150110233 C T 4626361
Genes possibly regulated by ZNF274[chr16:85648916-85649420]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:85648916-85649420]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results