EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:38675199-38676223]
Chromosome characteristics of ZNF274[chr17:38675199-38676223]
Back to top
Enhancers possibly regulated by ZNF274[chr17:38675199-38676223]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 38663309 38720551 enh17141
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr17 38674878 38675250 vista24726
VISTA
SNP sites on ZNF274[chr17:38675199-38676223]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 38675206 rs145478798 T TCC 4867795
chr17 38675209 rs183981226 C T 4867796
chr17 38675265 rs148476629 G GAGGGC 4867797
chr17 38675296 rs78790137 C T 4867798
chr17 38675308 rs189880523 C G 4867799
chr17 38675395 rs147986361 G A 4867800
chr17 38675446 rs374758467 C CCAGCTGCCTCCCCAACTACTTTCCTG 4867801
chr17 38675454 rs181694610 G A 4867802
chr17 38675475 rs552238320 AC A 4867803
chr17 38675570 rs550099957 C T 4867804
chr17 38675609 rs185463915 T C 4867805
chr17 38675661 rs116758967 C T 4867806
chr17 38675692 rs80248747 C T 4867807
chr17 38675696 rs79976385 A G 4867808
chr17 38675751 rs78341010 G A 4867809
chr17 38675767 rs79728128 G A 4867810
chr17 38675840 rs116922253 T C 4867811
chr17 38675863 rs74920325 C T 4867812
chr17 38675892 rs79944391 C T 4867813
chr17 38675904 rs190289297 C A,T 4867814
chr17 38676190 rs564384113 C T 4867815
Genes possibly regulated by ZNF274[chr17:38675199-38676223]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:38675199-38676223]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results