EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:41527990-41528890]
Chromosome characteristics of ZNF274[chr17:41527990-41528890]
Back to top
Enhancers possibly regulated by ZNF274[chr17:41527990-41528890]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 41518125 41539515 enh17169
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Kidney Prostate (RWPE1) Cervix (HeLa-S3) Esophagus Astrocyte Lung (A549) Stomach Placenta Thyroid Adrenal Lung (PC-9) Pancreas Spleen Muscle (Myotube) Uterus Heart
SNP sites on ZNF274[chr17:41527990-41528890]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 41528001 rs540087285 T G 4883610
chr17 41528102 rs549765099 T G 4883611
chr17 41528181 rs71382969 C G 4883612
chr17 41528247 rs142319980 G A 4883613
chr17 41528349 rs558603444 G C 4883614
chr17 41528401 rs559266971 C T 4883615
chr17 41528423 rs529938877 G A 4883616
chr17 41528461 rs187591033 C G,T 4883617
chr17 41528469 rs535042378 CAGATTTTTCTGCAGTCCAGA C 4883618
chr17 41528506 rs11656100 A G 4883619
chr17 41528572 rs56810958 G T 4883620
chr17 41528780 rs569735075 A G 4883621
chr17 41528842 rs185713697 T C 4883622
chr17 41528865 rs150358964 T A 4883623
chr17 41528888 rs59999559 C CT 4883624
Genes possibly regulated by ZNF274[chr17:41527990-41528890]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:41527990-41528890]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results