EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:41528085-41531278]
Chromosome characteristics of ZNF143[chr17:41528085-41531278]
Back to top
Enhancers possibly regulated by ZNF143[chr17:41528085-41531278]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 41518125 41539515 enh17169
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Kidney Prostate (RWPE1) Cervix (HeLa-S3) Esophagus Astrocyte Lung (A549) Stomach Placenta Thyroid Adrenal Lung (PC-9) Pancreas Spleen Muscle (Myotube) Uterus Heart
SNP sites on ZNF143[chr17:41528085-41531278]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 41528102 rs549765099 T G 4883611
chr17 41528181 rs71382969 C G 4883612
chr17 41528247 rs142319980 G A 4883613
chr17 41528349 rs558603444 G C 4883614
chr17 41528401 rs559266971 C T 4883615
chr17 41528423 rs529938877 G A 4883616
chr17 41528461 rs187591033 C G,T 4883617
chr17 41528469 rs535042378 CAGATTTTTCTGCAGTCCAGA C 4883618
chr17 41528506 rs11656100 A G 4883619
chr17 41528572 rs56810958 G T 4883620
chr17 41528780 rs569735075 A G 4883621
chr17 41528842 rs185713697 T C 4883622
chr17 41528865 rs150358964 T A 4883623
chr17 41528888 rs59999559 C CT 4883624
chr17 41528914 rs574645733 C T 4883625
chr17 41529072 rs576098210 C G,T 4883626
chr17 41529133 rs188728452 A T 4883627
chr17 41529155 rs111567022 C G 4883628
chr17 41529193 rs559957405 C T 4883629
chr17 41529197 rs530344330 G A 4883630
chr17 41529200 rs376994447 C G,T 4883631
chr17 41529254 rs570291608 C T 4883632
chr17 41529277 rs551026441 TGAG T 4883633
chr17 41529314 rs113377275 G T 4883634
chr17 41529418 rs570458851 G A 4883635
chr17 41529470 rs544549865 C A,T 4883636
chr17 41529515 rs191756248 G A 4883637
chr17 41529519 rs543509887 C G,T 4883638
chr17 41529538 rs564993286 G C 4883639
chr17 41529889 rs530398566 G A 4883640
chr17 41530046 rs376160012 C T 4883641
chr17 41530390 rs534432533 C A,G 4883642
chr17 41530406 rs567988393 C A 4883643
chr17 41530638 rs535722460 A T 4883644
chr17 41530669 rs568817151 T C 4883645
chr17 41530674 rs367691312 AG A 4883646
chr17 41530674 rs67242422 AG A 4883647
chr17 41530674 rs762575128 AG A 4883648
chr17 41530762 rs141481413 G A 4883649
chr17 41530794 rs2343860 G C 4883650
chr17 41530903 rs2880712 G T 4883651
chr17 41530962 rs567593991 AGAG A 4883652
chr17 41530966 rs575185192 AG A 4883653
chr17 41530967 rs528165002 G A 4883654
chr17 41530986 rs9894814 T C 4883655
chr17 41530987 rs9910371 G A,C 4883656
chr17 41530998 rs56124217 G C 4883657
chr17 41531023 rs2343859 C T 4883658
chr17 41531257 rs142555515 T G 4883659
Genes possibly regulated by ZNF143[chr17:41528085-41531278]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:41528085-41531278]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results