Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48972547 rs16949441 C T 4926659
chr17 48972559 rs56259615 G A 4926660
chr17 48972574 rs182788262 T C 4926661
chr17 48972616 rs368718904 CGGGCCACCCGCCTCCTGTGTCTCTTCA C 4926662
chr17 48972616 rs372291439 CGGGCCACCCGCCTCCTGTGTCTCTTCA C 4926663

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results