EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:48972588-48972810]
Chromosome characteristics of ZNF274[chr17:48972588-48972810]
Back to top
Enhancers possibly regulated by ZNF274[chr17:48972588-48972810]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48954425 48973436 enh32228
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Stomach Epithelial (MCF-7) Skin (Keratinocyte) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Lung (PC-9) Muscle (Myoblast) Liver (HepG2) Prostate (RWPE1)
SNP sites on ZNF274[chr17:48972588-48972810]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48972616 rs368718904 CGGGCCACCCGCCTCCTGTGTCTCTTCA C 4926662
chr17 48972616 rs372291439 CGGGCCACCCGCCTCCTGTGTCTCTTCA C 4926663
chr17 48972626 rs573838186 G A 4926664
chr17 48972647 rs542948445 C T 4926665
chr17 48972683 rs552994435 C T 4926666
Genes possibly regulated by ZNF274[chr17:48972588-48972810]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:48972588-48972810]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results