EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:48989299-48989529]
Chromosome characteristics of ZNF274[chr17:48989299-48989529]
Back to top
Enhancers possibly regulated by ZNF274[chr17:48989299-48989529]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48974385 49015197 enh4464
Bone Marrow (K562) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr17:48989299-48989529]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48989337 rs570056782 CCAAGGGTGACCCTTTCCCTGAGAT C 4926868
chr17 48989505 rs138908103 C T 4926869
chr17 48989523 rs149423893 C T 4926870
Genes possibly regulated by ZNF274[chr17:48989299-48989529]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:48989299-48989529]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results