Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1174025 1184042 enh17839

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1180238 rs78828368 C T 5372886
chr19 1180380 rs115717001 C T 5372887
chr19 1180416 rs577947388 G A 5372888
chr19 1180533 rs565988335 C T 5372889
chr19 1180534 rs138449220 G A 5372890
chr19 1180544 rs542713404 G A 5372891
chr19 1180565 rs72977562 C A 5372892
chr19 1180623 rs546848243 C A,T 5372893
chr19 1180665 rs570041191 T A 5372894
chr19 1180685 rs367844268 T A 5372895
chr19 1180838 rs137858143 GTCTGTCTCTGTCTCTGTCTCTA G 5372896
chr19 1180838 rs375998161 GTCTGTCTCTGTCTCTGTCTCTA G 5372897
chr19 1180970 rs557321838 T C 5372898
chr19 1181012 rs2380334 C T 5372899

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results