EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:13956571-13956908]
Chromosome characteristics of ZNF274[chr19:13956571-13956908]
Back to top
Enhancers possibly regulated by ZNF274[chr19:13956571-13956908]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 13941465 13967615 enh5016
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF274[chr19:13956571-13956908]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 13956573 rs71170574 AT A 5452050
chr19 13956605 rs183324534 A T 5452051
chr19 13956663 rs4271693 T C,G 5452052
chr19 13956770 rs115943584 C A 5452053
chr19 13956787 rs182836697 C T 5452054
chr19 13956788 rs573792460 G A 5452055
chr19 13956791 rs146972451 G T 5452056
chr19 13956849 rs562747050 T C 5452057
chr19 13956851 rs533297664 G C 5452058
chr19 13956870 rs138041782 A ATTTGTTTTGTTTTGT 5452059
chr19 13956870 rs61512280 A ATTTGTTTTGTTTTGT,ATTTGTTTTGTTTTGTTTTGTTTTGT 5452060
Genes possibly regulated by ZNF274[chr19:13956571-13956908]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:13956571-13956908]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 13947140 13947161 - hsa-miR-24-2-5p MIMAT0004497 13953731 0.639089 0.668807 2840 829
chr19 13947261 13947281 - hsa-miR-27a-3p MIMAT0000084 13953731 0.74941 0.0 2840 831
chr19 13947409 13947429 - hsa-miR-23a-3p MIMAT0000078 13953731 0.768964 0.0 2840 833
Expression level of miRNAs
Back to top