Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 14836354 14851760 enh26546

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 14850487 rs139151776 CGTTTTGTTTT C 96859
chr1 14850487 rs535794573 CGTTTTGTTTTGTTTTGTTTT C 96860
chr1 14850487 rs538750970 CGTTTTGTTTT C 96861

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results